ON-829: 5’- ACC ACC TCC GG-3’
ON-830: 5’- TTA CTT AGT TA-3’
LN (library of nucleotides): 5’- GA GGT GGT {NNK}n TAA CTA AGT AAAGC, where {NNK}n denotes a random region of the desired length ( 3x n) and sequence. NNK triplets specify random amino acids where Nis one of the four nucleotides (A, C, G, or T), and K is either Gor T.

Cloning site before digestion:

GGGCAGGTGGTGCATGGGGAGCAGGTGGGTGGTGAGGCCTCCGGGGCCGTTAACGGCCGTGGCCTAGCTGGCCAATAACCCGTCCACCACGTACCCCTCGTCCACCCACCACTCCGGAGGCCCCGGCAATTGCCGGCACCGGATCGACCGGTTATT

GQVVHGEQVGGEASGAVNGRGLAGQ*

Bacteria transformed with the recombinant plasmid library aregrown in the presence of arabinose to trigger the transcription ofthe LacI gene fused to the cloned random sequence. The recombinantpJS142 plasmid contained into these arabinose-induced bacteria isthen purified under experimental conditions that preserveDNA-protein interaction.

In vitro binding assay: The purified recombinant plasmids arethen incubated with the protein s70 conjugated to beads and dilutedin binding buffer. After centrifugation, the pellet of beads iswashed several times and then bound plasmids are eluted andre-transformed into bacteria. This process is repeated severaltimes to obtained a collection of plasmid enriched inplasmid/protein complexes that specifically bind to s70.

1) What would happen if lactose were added to the bindingbuffer?